Categories Products for NMR Oligo Synthesis Service Enzymatic Oligo-Synthesis
Enzymatic Oligo-Synthesis
Silantes provides an enzymatic synthesis service for DNA and RNA labelled with the stable isotopes 2H, 13C and 15N and combinations thereof. This enzymatic approach allows uniform labelling of DNA and RNA fragments. For a nucleoside-specific labelling, please see our custom chemical oligo-synthesis service.
The technology
The RNA synthesis is performed in the T7 RNA-polymerase system. The reaction is started by adding the T7 RNA-polymerase enzyme to a buffered mixture containing
- double stranded DNA templates containing the promoter for T7 RNA polymerase as well as the sequence for RNA product,
- rNTPs and
- ions of magnesium.
The DNA synthesis is performed in a mixture containing
- DNA-template (complementary to the product and the primer),
- Deoxynucleotide primer,
- Klenow fragment and
- dNTPs.
The performance of the reactions are monitored and analyzed by ion-exchange chromatography. The figures show elution profiles of a r14mer RNA fragment after 2 h (left) and a d15mer DNA fragment after 6 h (right).
Figure: Elution profiles of a r14mer RNA fragment after 2 h (left) and a d15mer DNA fragment after 6 h (right).
We offer purification by HPLC. The amount of the products is counted in optical units and re-calculated into nmol using a special coefficient.
The price of the synthesis service
Please send us
- length of the oligo,
- sequence of the oligo (RNA sequences require a 5’-GG end),
- isotopic labelling and
- quantity.
Based on this information, we conduct a feasibility study for your project priced at 620 €. If the project is feasible and the synthesis service is ordered, the costs for the feasibility study get reimbursed.
The delivery time is 6 weeks.
Exemplary project
With our custom oligo synthesis service, we conduced a great number of prestigious projects to success. One example is the following synthesis of an E.coli promoter sequence:
Length: 23-mer
Sequence: d(GGGACACGGCGAATAGCCATCCC)
Isotopic labelling: 13C, 15N (uniformly, >98 %)
Quantity: 1 mg
This project was successfully realized at a price of 2380 €.
Related topics: Custom chemical oligo-synthesis service | Stable isotope labelled compounds for NMR studies
